Sequence retrieval

Genome: Pirellula sp.
Start position: 5690025
End position: 5690048
Length: 24

DNA sequence
>NC_005027, from 5690025 to 5690048 (24 bp); Pirellula sp. GTCTTCCTCTTCGTCGTCGACTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5689099-5691714	Sequence	RB10488 - sensory transduction histidine kinase- sensory histidine kinase / response regulator hybrid (Protein is coded in complementary strand; from 5691714 to 5689099)