Sequence retrieval

Genome: Pirellula sp.
Start position: 5632410
End position: 5632454
Length: 45

DNA sequence
>NC_005027, from 5632410 to 5632454 (45 bp); Pirellula sp. AGGAGGCGGTGGTGGTGGAGGAGGCGGTGGTGGAGGAGGCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5630383-5634441	Sequence	RB10413 - hypothetical protein (Protein is coded in complementary strand; from 5634441 to 5630383)