Sequence retrieval

Genome: Pirellula sp.
Start position: 5344007
End position: 5344030
Length: 24

DNA sequence
>NC_005027, from 5344007 to 5344030 (24 bp); Pirellula sp. TCCGCCTCCACCTCCACCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5343861-5344370	Sequence	RB9917 ssb single-strand binding protein (Protein is coded in complementary strand; from 5344370 to 5343861)