Sequence retrieval

Genome: Pirellula sp.
Start position: 4790691
End position: 4790724
Length: 34

DNA sequence
>NC_005027, from 4790691 to 4790724 (34 bp); Pirellula sp. GCTCCTAGCTCCTAGCTCCTAGCTCCTAGCTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4790710-4790856	Sequence	RB8987 - hypothetical protein (Protein is coded in complementary strand; from 4790856 to 4790710)