Sequence retrieval

Genome: Pirellula sp.
Start position: 4701333
End position: 4701362
Length: 30

DNA sequence
>NC_005027, from 4701333 to 4701362 (30 bp); Pirellula sp. GCCAAACAAACCCAAACAACGCCAACCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4700391-4701458	Sequence	RB8838 - nucleotide pyrophosphatase-like protein (Protein is coded in complementary strand; from 4701458 to 4700391)