Sequence retrieval

Genome: Pirellula sp.
Start position: 4247233
End position: 4247257
Length: 25

DNA sequence
>NC_005027, from 4247233 to 4247257 (25 bp); Pirellula sp. CTTCTTCTTCTTTTTCTTCTTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4247111-4249921	Sequence	RB7957 topA DNA topoisomerase I (Protein is coded in complementary strand; from 4249921 to 4247111)