Sequence retrieval

Genome: Pirellula sp.
Start position: 3962923
End position: 3962964
Length: 42

DNA sequence
>NC_005027, from 3962923 to 3962964 (42 bp); Pirellula sp. GATCTGCACAGGCCAATCTGCACAGGCCGATCTGTACTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3962837-3963070	Sequence	RB7409 - hypothetical protein (Protein is coded in complementary strand; from 3963070 to 3962837)