Sequence retrieval

Genome: Pirellula sp.
Start position: 3730686
End position: 3730732
Length: 47

DNA sequence
>NC_005027, from 3730686 to 3730732 (47 bp); Pirellula sp. CCGTAACCCTGCATTCCCGATCCCTGCATTCCCGATCCCTGCATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3730620-3731789	Sequence	RB7012 - hypothetical protein (Protein is coded in complementary strand; from 3731789 to 3730620)