Sequence retrieval

Genome: Pirellula sp.
Start position: 3220866
End position: 3220903
Length: 38

DNA sequence
>NC_005027, from 3220866 to 3220903 (38 bp); Pirellula sp. CCCATGCCGCCGCCCATGCCGCCGCCCATGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3219093-3223592	Sequence	RB6127 - signal peptide (Protein is coded in complementary strand; from 3223592 to 3219093)