Sequence retrieval

Genome: Pirellula sp.
Start position: 2907315
End position: 2907354
Length: 40

DNA sequence
>NC_005027, from 2907315 to 2907354 (40 bp); Pirellula sp. AGGTCACCGCTCGATGTCACCGCTAGGGGTCACCGGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2907345-2908004	Sequence	RB5587 - signal peptide (Protein is coded in complementary strand; from 2908004 to 2907345)