Sequence retrieval

Genome: Pirellula sp.
Start position: 2390751
End position: 2390795
Length: 45

DNA sequence
>NC_005027, from 2390751 to 2390795 (45 bp); Pirellula sp. CCACGAGGGTCACGACCATGACGGGCACGATCATGAGGGTCATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2390414-2391079	Sequence	RB4676 - hypothetical protein (Protein is coded in complementary strand; from 2391079 to 2390414)
ORF. 2390618-2391217	Sequence	RB4678 - signal peptide