Sequence retrieval

Genome: Pirellula sp.
Start position: 1342308
End position: 1342331
Length: 24

DNA sequence
>NC_005027, from 1342308 to 1342331 (24 bp); Pirellula sp. TTCTTCTTGTTCTTTTTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1342305-1342592	Sequence	RB2577 - ethanolamine utilization protein EutN (Protein is coded in complementary strand; from 1342592 to 1342305)