Sequence retrieval

Genome: Pirellula sp.
Start position: 1072321
End position: 1072347
Length: 27

DNA sequence
>NC_005027, from 1072321 to 1072347 (27 bp); Pirellula sp. CCGTTGCCGTAGCCGTTACCGTTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1071604-1076265	Sequence	RB2038 - hypothetical protein (Protein is coded in complementary strand; from 1076265 to 1071604)