Sequence retrieval

Genome: Pirellula sp.
Start position: 1025971
End position: 1026007
Length: 37

DNA sequence
>NC_005027, from 1025971 to 1026007 (37 bp); Pirellula sp. TGTTGTTGCTGCTGCTGTTGTTGCTGTTTCTGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1025731-1026966	Sequence	RB1946 - signal peptide (Protein is coded in complementary strand; from 1026966 to 1025731)