Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 71453
End position: 71476
Length: 24

DNA sequence
>NC_004337, from 71453 to 71476 (24 bp); Shigella flexneri 2a str 301 GCAGCAACAGCAGCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 70753-72363	Sequence	SF0062 thiP thiamine ABC transporter permease (Protein is coded in complementary strand; from 72363 to 70753)