Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 586356
End position: 586388
Length: 33

DNA sequence
>NC_004337, from 586356 to 586388 (33 bp); Shigella flexneri 2a str 301 TAATTAACTTATAATTATATTATAATTAACTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 586371-586598	Sequence	SF0564a - hypothetical protein (Protein is coded in complementary strand; from 586598 to 586371)