Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 580036
End position: 580080
Length: 45

DNA sequence
>NC_004337, from 580036 to 580080 (45 bp); Shigella flexneri 2a str 301 TCTGCGGCAGCTTTTGCTGCAGCGGCTTTTTCAGCTGCTGCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 579649-580890	Sequence	SF0558 tolA cell envelope integrity inner membrane protein TolA (Protein is coded in complementary strand; from 580890 to 579649)