Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 4169563
End position: 4169592
Length: 30

DNA sequence
>NC_004337, from 4169563 to 4169592 (30 bp); Shigella flexneri 2a str 301 CGCGGTAAATCTCGATAAATGGCGGTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4168451-4169602	Sequence	SF4034 argE acetylornithine deacetylase (Protein is coded in complementary strand; from 4169602 to 4168451)