Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 4119888
End position: 4119911
Length: 24

DNA sequence
>NC_004337, from 4119888 to 4119911 (24 bp); Shigella flexneri 2a str 301 ACCAACATCAACACCAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4118585-4119958	Sequence	SF3990 cpxA two-component sensor protein (Protein is coded in complementary strand; from 4119958 to 4118585)