Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 3147524
End position: 3147548
Length: 25

DNA sequence
>NC_004337, from 3147524 to 3147548 (25 bp); Shigella flexneri 2a str 301 CCTTTGCTTTCTTTTCCTTGCGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3147417-3147572	Sequence	SF3052 - hypothetical protein (Protein is coded in complementary strand; from 3147572 to 3147417)