Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 2923017
End position: 2923059
Length: 43

DNA sequence
>NC_004337, from 2923017 to 2923059 (43 bp); Shigella flexneri 2a str 301 CACCATCAGCACCATCAGCACCATCAGCACCATCAGCACCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2922765-2923115	Sequence	SF2834 ppdC hypothetical protein (Protein is coded in complementary strand; from 2923115 to 2922765)