Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 2880791
End position: 2880835
Length: 45

DNA sequence
>NC_004337, from 2880791 to 2880835 (45 bp); Shigella flexneri 2a str 301 TAAACATCGACCAGATAAAGATCGACCAGATAAAGATCGACCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2879733-2881100	Sequence	SF2802 - transporter (Protein is coded in complementary strand; from 2881100 to 2879733)