Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 2816648
End position: 2816695
Length: 48

DNA sequence
>NC_004337, from 2816648 to 2816695 (48 bp); Shigella flexneri 2a str 301 CCCAGCCCCAGCCCCAGCCCCAGCCCCAGCCCCAGCCCCAGCCCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2815732-2817549	Sequence	SF2740 hycC formate hydrogenlyase subunit 3 (Protein is coded in complementary strand; from 2817549 to 2815732)