Sequence retrieval

Genome: Shigella flexneri 2a str 301
Start position: 1578395
End position: 1578418
Length: 24

DNA sequence
>NC_004337, from 1578395 to 1578418 (24 bp); Shigella flexneri 2a str 301 ACCTTGTTACCTAGTTACCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1578402-1579223	Sequence	SF1544 - antitermination protein (Protein is coded in complementary strand; from 1579223 to 1578402)