Sequence retrieval

Genome: Thermosynechococcus elongatus BP-1
Start position: 1995080
End position: 1995134
Length: 55

DNA sequence
>NC_004113, from 1995080 to 1995134 (55 bp); Thermosynechococcus elongatus BP-1 GTTCACCGCGTTCACCGTATTCACCCCGCTCACCGTATTCACCCCGTTCACCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1995052-1995327	Sequence	tsl1908 - hypothetical protein (Protein is coded in complementary strand; from 1995327 to 1995052)