Sequence retrieval

Genome: Thermosynechococcus elongatus BP-1
Start position: 109569
End position: 109598
Length: 30

DNA sequence
>NC_004113, from 109569 to 109598 (30 bp); Thermosynechococcus elongatus BP-1 GGTAGGGGTTAGGGGGCAGGGGGTCGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 108926-110614	Sequence	tll0130 menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase (Protein is coded in complementary strand; from 110614 to 108926)