Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 918928
End position: 918986
Length: 59

DNA sequence
>NC_003552, from 918928 to 918986 (59 bp); Methanosarcina acetivorans str. C2A GCTGACGAAGAAGTAGCTGACGAAGAAGTAGCTGACGAAGAAGTAGCTGACGAAGAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 918668-919108	Sequence	MA0785 - proteophosphoglycan (Protein is coded in complementary strand; from 919108 to 918668)