Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 859544
End position: 859607
Length: 64

DNA sequence
>NC_003552, from 859544 to 859607 (64 bp); Methanosarcina acetivorans str. C2A CTCTTTGTTTCAAATCCTTTTTGTTTTAAGTCTTCTTCGTTTCAAATCTTCTTCGTTTCAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 858898-859557	Sequence	MA0739 - hypothetical protein (Protein is coded in complementary strand; from 859557 to 858898)