Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 5647497
End position: 5647539
Length: 43

DNA sequence
>NC_003552, from 5647497 to 5647539 (43 bp); Methanosarcina acetivorans str. C2A CCCGAGTTTCGTTTCCCGAGTTTCGCTTCCCGAGTTTCGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5647234-5647611	Sequence	MA4586 - hypothetical protein (Protein is coded in complementary strand; from 5647611 to 5647234)