Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 5470580
End position: 5470618
Length: 39

DNA sequence
>NC_003552, from 5470580 to 5470618 (39 bp); Methanosarcina acetivorans str. C2A TTTCCTCCATCATTTCCGCCTTCATTTCATCCTTCATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5470498-5471319	Sequence	MA4426 - MotA/TolQ/ExbB proton channel family protein (Protein is coded in complementary strand; from 5471319 to 5470498)