Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 526257
End position: 526307
Length: 51

DNA sequence
>NC_003552, from 526257 to 526307 (51 bp); Methanosarcina acetivorans str. C2A TTCTTCACACGTTATTCTTCACACGTTATTCTTCACACGTTATTCTTCACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 526304-526483	Sequence	MA0446 - hypothetical protein (Protein is coded in complementary strand; from 526483 to 526304)