Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 4798451
End position: 4798474
Length: 24

DNA sequence
>NC_003552, from 4798451 to 4798474 (24 bp); Methanosarcina acetivorans str. C2A TGCCCTTGCCCGGGCCCTTGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4797994-4799124	Sequence	MA3903 - sugar ABC transporter ATP-binding protein