Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 4484924
End position: 4484971
Length: 48

DNA sequence
>NC_003552, from 4484924 to 4484971 (48 bp); Methanosarcina acetivorans str. C2A ACAGCCATCTTATGTTCCAACGATCTTATGTTTCAACTATCTTATGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4483667-4484944	Sequence	MA3638 - hypothetical protein (Protein is coded in complementary strand; from 4484944 to 4483667)