Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 4372791
End position: 4372854
Length: 64

DNA sequence
>NC_003552, from 4372791 to 4372854 (64 bp); Methanosarcina acetivorans str. C2A CAGGGAAACTCCCGTATAAATCAAAGAAATTCCCATATAAATCAAAGAAACTCCCATATATATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4372745-4372984	Sequence	MA3536 - hypothetical protein (Protein is coded in complementary strand; from 4372984 to 4372745)