Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 4136087
End position: 4136150
Length: 64

DNA sequence
>NC_003552, from 4136087 to 4136150 (64 bp); Methanosarcina acetivorans str. C2A ATCGTTCGTCTCCGCATCGTTCGTCTCCGCATCGTTCGCCTCCGCATCGTTCGCCTCCGCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4135350-4136300	Sequence	MA3349 - hypothetical protein (Protein is coded in complementary strand; from 4136300 to 4135350)