Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 4115061
End position: 4115090
Length: 30

DNA sequence
>NC_003552, from 4115061 to 4115090 (30 bp); Methanosarcina acetivorans str. C2A GAATTTTTAGCCATTTTTAGTCATTTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4114863-4115075	Sequence	MA3333 - hypothetical protein (Protein is coded in complementary strand; from 4115075 to 4114863)