Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 38550
End position: 38612
Length: 63

DNA sequence
>NC_003552, from 38550 to 38612 (63 bp); Methanosarcina acetivorans str. C2A ATCCCCTGTTGAATCATCCCCTGTTGAATCATCCCCTGTTGAATCATCCCCTGTTGAATCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 37882-39162	Sequence	MA0029 - hypothetical protein (Protein is coded in complementary strand; from 39162 to 37882)