Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 3831313
End position: 3831362
Length: 50

DNA sequence
>NC_003552, from 3831313 to 3831362 (50 bp); Methanosarcina acetivorans str. C2A TTAACTGTACCATTAACTGTACCATTAACTGTACCATTAACTGTACCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3831310-3834120	Sequence	MA3087 - hypothetical protein (Protein is coded in complementary strand; from 3834120 to 3831310)