Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 3725565
End position: 3725604
Length: 40

DNA sequence
>NC_003552, from 3725565 to 3725604 (40 bp); Methanosarcina acetivorans str. C2A TTTTTACCCTTGTTTTTATCCTTGTTTTTGGCCTTGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3724892-3725677	Sequence	MA2988 trpF phosphoribosylanthranilate isomerase (Protein is coded in complementary strand; from 3725677 to 3724892)
ORF... 3725605-3726717	Sequence	MA2989 trpD anthranilate phosphoribosyltransferase (Protein is coded in complementary strand; from 3726717 to 3725605)