Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 3709925
End position: 3709948
Length: 24

DNA sequence
>NC_003552, from 3709925 to 3709948 (24 bp); Methanosarcina acetivorans str. C2A GGGAAGGAAGGAAGGATGGAAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3709748-3710200	Sequence	MA2974 - hypothetical protein (Protein is coded in complementary strand; from 3710200 to 3709748)