Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 3675331
End position: 3675354
Length: 24

DNA sequence
>NC_003552, from 3675331 to 3675354 (24 bp); Methanosarcina acetivorans str. C2A TAATTTTAAATTTTGAATTTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3674094-3675620	Sequence	MA2943 - hypothetical protein (Protein is coded in complementary strand; from 3675620 to 3674094)