Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 3612618
End position: 3612641
Length: 24

DNA sequence
>NC_003552, from 3612618 to 3612641 (24 bp); Methanosarcina acetivorans str. C2A GTTTCCGTTTTCTTTTCCATTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3611767-3613050	Sequence	MA2893 - hypothetical protein (Protein is coded in complementary strand; from 3613050 to 3611767)