Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 3555944
End position: 3555980
Length: 37

DNA sequence
>NC_003552, from 3555944 to 3555980 (37 bp); Methanosarcina acetivorans str. C2A GGGTCCAGAGAAGGGTCCAGAGAAGAATCCAGAGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3555781-3556011	Sequence	MA4676 - hypothetical protein (Protein is coded in complementary strand; from 3556011 to 3555781)