Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 328700
End position: 328723
Length: 24

DNA sequence
>NC_003552, from 328700 to 328723 (24 bp); Methanosarcina acetivorans str. C2A TCTTCTTCTTCTTCTCCTTCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 328505-329227	Sequence	MA0272 mtrA tetrahydromethanopterin S-methyltransferase subunit A (Protein is coded in complementary strand; from 329227 to 328505)