Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 3215759
End position: 3215782
Length: 24

DNA sequence
>NC_003552, from 3215759 to 3215782 (24 bp); Methanosarcina acetivorans str. C2A TTGGCGCTGGCGCTGGCGTTTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3213869-3216559	Sequence	MA2584 - hypothetical protein (Protein is coded in complementary strand; from 3216559 to 3213869)