Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 3149809
End position: 3149833
Length: 25

DNA sequence
>NC_003552, from 3149809 to 3149833 (25 bp); Methanosarcina acetivorans str. C2A AAAGGAATGGAACGGAAAGGAATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3149406-3150620	Sequence	MA2533 pncB nicotinate phosphoribosyltransferase