Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 310046
End position: 310076
Length: 31

DNA sequence
>NC_003552, from 310046 to 310076 (31 bp); Methanosarcina acetivorans str. C2A GATGAAAATAAATGAAACTACATGAAAATAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 309318-310061	Sequence	MA0255 - 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate synthesis protein ThiF