Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 3030435
End position: 3030484
Length: 50

DNA sequence
>NC_003552, from 3030435 to 3030484 (50 bp); Methanosarcina acetivorans str. C2A TTTTTCAATAATCCTCTTTTTCAATAATCTTCTTGCTCAACAATCCTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3030456-3030965	Sequence	MA2443 - hypothetical protein (Protein is coded in complementary strand; from 3030965 to 3030456)