Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 2927534
End position: 2927583
Length: 50

DNA sequence
>NC_003552, from 2927534 to 2927583 (50 bp); Methanosarcina acetivorans str. C2A GTAACTCGGGCCGTAACTCGGGCCGTAACTCGGGCCGTAACTCGGGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2927245-2928777	Sequence	MA2369 recG ATP-dependent DNA helicase (Protein is coded in complementary strand; from 2928777 to 2927245)