Sequence retrieval

Genome: Methanosarcina acetivorans str. C2A
Start position: 28588
End position: 28615
Length: 28

DNA sequence
>NC_003552, from 28588 to 28615 (28 bp); Methanosarcina acetivorans str. C2A TTCTTCTTCTGCTTCATCTCCTTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 28098-28652	Sequence	MA0020 cheW2 chemotaxis signal transduction coupling protein